dr alice ting (Addgene inc)
Addgene inc is a verified supplier 
95
Structured Review
Addgene inc
dr alice ting
Dr Alice Ting, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 99 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dr+alice+ting/V5-TurboID-NES_pCDNA3+(Plasmid+%23107169)/pmc12592424-298-5-8
Average 95 stars, based on 99 article reviews
Dr Alice Ting, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 99 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dr+alice+ting/V5-TurboID-NES_pCDNA3+(Plasmid+%23107169)/pmc12592424-298-5-8
Average 95 stars, based on 99 article reviews
dr alice ting - by Bioz Stars,
2026-09
95/100 stars
Images
Related Articles
Clone Assay:Article Title: Prefrontal cortex astrocytes modulate distinct neuronal populations to control anxiety-like behavior Article Snippet: .. The cDNA of the TurboID enzyme gene was cloned into pZac2.1 containing the astrocyte specific promoter GfaABC 1 D . V5-TurboID-NES-pCDNA3 was kindly shared by Article Title: Prefrontal cortex astrocytes modulate distinct neuronal populations to control anxiety-like behavior. Article Snippet: .. V5-TurboID-NESpCDNA3 was kindly shared by Article Title: Molecular profiling of brain endothelial cell to astrocyte endfoot communication in mouse and human Article Snippet: The pZac2.1-GfaABC 1 D-tdTomato plasmid used as the control AAV was kindly shared by Dr. Baljit S. Khakh (Addgene Cat# 44332). pZac2.1-GfaABC1D-GFP was generated by excising GFP with BamHI from pZac2.1-GfaABC1D-AQP4-GFP, a gift from Dr. Baljit S. Khakh, and amplifying with the following primers before inserting into the BamHI site of the pZac2.1-GfaABC1D vector using the In-fusion® HD Cloning kit (Takara Cat# 639650): Forward: 5’ CCTCGAGCTCGGATCCGCCACCATGGTGAGCAAGGGCGAGGAG 3’; Reverse: 5’ TAAGCGAATTGGATCCTTACTTGTACAGCTCGTCCAT 3’. .. CMV-V5-TurboID-NES-pCDNA3 was kindly shared by Plasmid Preparation:Article Title: Prefrontal cortex astrocytes modulate distinct neuronal populations to control anxiety-like behavior Article Snippet: .. The cDNA of the TurboID enzyme gene was cloned into pZac2.1 containing the astrocyte specific promoter GfaABC 1 D . V5-TurboID-NES-pCDNA3 was kindly shared by Article Title: Engineering of photo-inducible binary interaction tools for biomedical applications Article Snippet: .. The PRESTO-Tango plasmid kit was a gift from Bryan Roth (Addgene kit # 1000000068). cPAR1-4-Tango variants were generated by truncating the N-terminal sequence at the reported protease cleavage sites. ssrA tags were added to the N-termini of cPAR1-4 by introducing forward primers and PCR amplifying the whole cPAR1-4 plasmids together with reverse primers. pDisplay-LOV2-sspB was generated by replacing the mSA of pDisplay-mSA-EGFP-TM (Addgene # 39863) with sspB-LOV2 using ApaI and AscI, followed by deletion of EGFP using PCR. pAAV-beta-arrestin2-HA-TEV219 was a gift from Article Title: Prefrontal cortex astrocytes modulate distinct neuronal populations to control anxiety-like behavior. Article Snippet: .. V5-TurboID-NESpCDNA3 was kindly shared by Article Title: Feedback-Driven Mechanisms between Microtubules and the Endoplasmic Reticulum Instruct Neuronal Polarity. Article Snippet: The following vectors were used: pEGFP(A206K)-N1 and pEGFP(A206K)-C1 (a gift from Dr. Jennifer Lippincott-Schwartz), pmCherry-N1 and mCherry-C1 (Clontech), pGW1-BFP (Kapitein et al., 2010), pSuper (Brummelkamp et al., 2002) and MARCKSGFP (De Paola et al., 2003). .. GFP-KIF5A-Rigor was kindly provided by Dr. Juan Bonifacino (Farı́as et al., 2015), RTN4A-GFP was a gift from Dr. Gia Voeltz (Shibata et al., 2008; Addgene plasmid # 61807), GFP-ATL1 (Wang et al., 2016; Addgene # 86679) GFPSec61b (Addgene # 15108) and RFP-CLIMP63 were a gift from Dr. Tom Rapoport, GFP-P180 full length was a gift from Article Title: Molecular profiling of brain endothelial cell to astrocyte endfoot communication in mouse and human Article Snippet: The pZac2.1-GfaABC 1 D-tdTomato plasmid used as the control AAV was kindly shared by Dr. Baljit S. Khakh (Addgene Cat# 44332). pZac2.1-GfaABC1D-GFP was generated by excising GFP with BamHI from pZac2.1-GfaABC1D-AQP4-GFP, a gift from Dr. Baljit S. Khakh, and amplifying with the following primers before inserting into the BamHI site of the pZac2.1-GfaABC1D vector using the In-fusion® HD Cloning kit (Takara Cat# 639650): Forward: 5’ CCTCGAGCTCGGATCCGCCACCATGGTGAGCAAGGGCGAGGAG 3’; Reverse: 5’ TAAGCGAATTGGATCCTTACTTGTACAGCTCGTCCAT 3’. .. CMV-V5-TurboID-NES-pCDNA3 was kindly shared by Article Title: In-Cell Chemical Crosslinking Identifies Hotspots for SQSTM-1/p62-IκBα Interaction That Underscore a Critical Role of p62 in Limiting NF-κB Activation Through IκBα Stabilization. Article Snippet: .. pSpCas9(BB)-2A-Puro (PX459) was a gift from Dr Feng Zhang (Addgene plasmid # 48139; http://n2t.net/addgene:48139; RRID: Addgene_48139) (25). pCMV-3HA-IκBα and pCMV-3HA-IκBα-S32A/ S36A were gifts from Dr Warner Greene (plasmids #21985, #24143; Addgene). pLX304-Flag-APEX2-NES were gifts from Sequencing:Article Title: Prefrontal cortex astrocytes modulate distinct neuronal populations to control anxiety-like behavior Article Snippet: .. The cDNA of the TurboID enzyme gene was cloned into pZac2.1 containing the astrocyte specific promoter GfaABC 1 D . V5-TurboID-NES-pCDNA3 was kindly shared by Article Title: Engineering of photo-inducible binary interaction tools for biomedical applications Article Snippet: .. The PRESTO-Tango plasmid kit was a gift from Bryan Roth (Addgene kit # 1000000068). cPAR1-4-Tango variants were generated by truncating the N-terminal sequence at the reported protease cleavage sites. ssrA tags were added to the N-termini of cPAR1-4 by introducing forward primers and PCR amplifying the whole cPAR1-4 plasmids together with reverse primers. pDisplay-LOV2-sspB was generated by replacing the mSA of pDisplay-mSA-EGFP-TM (Addgene # 39863) with sspB-LOV2 using ApaI and AscI, followed by deletion of EGFP using PCR. pAAV-beta-arrestin2-HA-TEV219 was a gift from Article Title: Molecular profiling of brain endothelial cell to astrocyte endfoot communication in mouse and human Article Snippet: The pZac2.1-GfaABC 1 D-tdTomato plasmid used as the control AAV was kindly shared by Dr. Baljit S. Khakh (Addgene Cat# 44332). pZac2.1-GfaABC1D-GFP was generated by excising GFP with BamHI from pZac2.1-GfaABC1D-AQP4-GFP, a gift from Dr. Baljit S. Khakh, and amplifying with the following primers before inserting into the BamHI site of the pZac2.1-GfaABC1D vector using the In-fusion® HD Cloning kit (Takara Cat# 639650): Forward: 5’ CCTCGAGCTCGGATCCGCCACCATGGTGAGCAAGGGCGAGGAG 3’; Reverse: 5’ TAAGCGAATTGGATCCTTACTTGTACAGCTCGTCCAT 3’. .. CMV-V5-TurboID-NES-pCDNA3 was kindly shared by Amplification:Article Title: Prefrontal cortex astrocytes modulate distinct neuronal populations to control anxiety-like behavior Article Snippet: .. The cDNA of the TurboID enzyme gene was cloned into pZac2.1 containing the astrocyte specific promoter GfaABC 1 D . V5-TurboID-NES-pCDNA3 was kindly shared by Article Title: Molecular profiling of brain endothelial cell to astrocyte endfoot communication in mouse and human Article Snippet: The pZac2.1-GfaABC 1 D-tdTomato plasmid used as the control AAV was kindly shared by Dr. Baljit S. Khakh (Addgene Cat# 44332). pZac2.1-GfaABC1D-GFP was generated by excising GFP with BamHI from pZac2.1-GfaABC1D-AQP4-GFP, a gift from Dr. Baljit S. Khakh, and amplifying with the following primers before inserting into the BamHI site of the pZac2.1-GfaABC1D vector using the In-fusion® HD Cloning kit (Takara Cat# 639650): Forward: 5’ CCTCGAGCTCGGATCCGCCACCATGGTGAGCAAGGGCGAGGAG 3’; Reverse: 5’ TAAGCGAATTGGATCCTTACTTGTACAGCTCGTCCAT 3’. .. CMV-V5-TurboID-NES-pCDNA3 was kindly shared by Polymerase Chain Reaction:Article Title: Prefrontal cortex astrocytes modulate distinct neuronal populations to control anxiety-like behavior Article Snippet: .. The cDNA of the TurboID enzyme gene was cloned into pZac2.1 containing the astrocyte specific promoter GfaABC 1 D . V5-TurboID-NES-pCDNA3 was kindly shared by Article Title: Engineering of photo-inducible binary interaction tools for biomedical applications Article Snippet: .. The PRESTO-Tango plasmid kit was a gift from Bryan Roth (Addgene kit # 1000000068). cPAR1-4-Tango variants were generated by truncating the N-terminal sequence at the reported protease cleavage sites. ssrA tags were added to the N-termini of cPAR1-4 by introducing forward primers and PCR amplifying the whole cPAR1-4 plasmids together with reverse primers. pDisplay-LOV2-sspB was generated by replacing the mSA of pDisplay-mSA-EGFP-TM (Addgene # 39863) with sspB-LOV2 using ApaI and AscI, followed by deletion of EGFP using PCR. pAAV-beta-arrestin2-HA-TEV219 was a gift from Article Title: Molecular profiling of brain endothelial cell to astrocyte endfoot communication in mouse and human Article Snippet: The pZac2.1-GfaABC 1 D-tdTomato plasmid used as the control AAV was kindly shared by Dr. Baljit S. Khakh (Addgene Cat# 44332). pZac2.1-GfaABC1D-GFP was generated by excising GFP with BamHI from pZac2.1-GfaABC1D-AQP4-GFP, a gift from Dr. Baljit S. Khakh, and amplifying with the following primers before inserting into the BamHI site of the pZac2.1-GfaABC1D vector using the In-fusion® HD Cloning kit (Takara Cat# 639650): Forward: 5’ CCTCGAGCTCGGATCCGCCACCATGGTGAGCAAGGGCGAGGAG 3’; Reverse: 5’ TAAGCGAATTGGATCCTTACTTGTACAGCTCGTCCAT 3’. .. CMV-V5-TurboID-NES-pCDNA3 was kindly shared by Article Title: In-Cell Chemical Crosslinking Identifies Hotspots for SQSTM-1/p62-IκBα Interaction That Underscore a Critical Role of p62 in Limiting NF-κB Activation Through IκBα Stabilization. Article Snippet: .. pSpCas9(BB)-2A-Puro (PX459) was a gift from Dr Feng Zhang (Addgene plasmid # 48139; http://n2t.net/addgene:48139; RRID: Addgene_48139) (25). pCMV-3HA-IκBα and pCMV-3HA-IκBα-S32A/ S36A were gifts from Dr Warner Greene (plasmids #21985, #24143; Addgene). pLX304-Flag-APEX2-NES were gifts from Generated:Article Title: Engineering of photo-inducible binary interaction tools for biomedical applications Article Snippet: .. The PRESTO-Tango plasmid kit was a gift from Bryan Roth (Addgene kit # 1000000068). cPAR1-4-Tango variants were generated by truncating the N-terminal sequence at the reported protease cleavage sites. ssrA tags were added to the N-termini of cPAR1-4 by introducing forward primers and PCR amplifying the whole cPAR1-4 plasmids together with reverse primers. pDisplay-LOV2-sspB was generated by replacing the mSA of pDisplay-mSA-EGFP-TM (Addgene # 39863) with sspB-LOV2 using ApaI and AscI, followed by deletion of EGFP using PCR. pAAV-beta-arrestin2-HA-TEV219 was a gift from other:Article Title: S-Palmitoylation of junctophilin-2 is critical for its role in tethering the sarcoplasmic reticulum to the plasma membrane Article Snippet: Cysteine to alanine mutations in JPH2-GFP were created using Q5 site directed mutagenesis kit (NEB) and verified by DNA sequencing. Synthesized:Article Title: In-Cell Chemical Crosslinking Identifies Hotspots for SQSTM-1/p62-IκBα Interaction That Underscore a Critical Role of p62 in Limiting NF-κB Activation Through IκBα Stabilization. Article Snippet: .. pSpCas9(BB)-2A-Puro (PX459) was a gift from Dr Feng Zhang (Addgene plasmid # 48139; http://n2t.net/addgene:48139; RRID: Addgene_48139) (25). pCMV-3HA-IκBα and pCMV-3HA-IκBα-S32A/ S36A were gifts from Dr Warner Greene (plasmids #21985, #24143; Addgene). pLX304-Flag-APEX2-NES were gifts from |